Dengue virus DENV-2 (strain New Guinea C) NS4B Gene ORF cDNA clone expression plasmid, N-Myc tag

Price:
Size:
Number:

Dengue virus DENV-2 (strain New Guinea C) NS4B Gene ORF cDNA clone expression plasmid, N-Myc tag: General Information

Gene
Species
DENV
NCBI Ref Seq
RefSeq ORF Size
744 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence AF038403.1 (6826..7569), corresponding to amino acid sequence AAC59275.1 (aa 2244-2491).
Description
Full length Clone DNA of DENV-2 (strain New Guinea C) NS4B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DENV-NS4B cDNA ORF Clone, DENV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.