Ebola virus EBOV (subtype Zaire, Guinea 2014) RNA polymerase L partial natural Gene ORF cDNA clone expression plasmid

1/1
Price:
Size:
Number:

Ebola virus EBOV (subtype Zaire, Guinea 2014) RNA polymerase L partial natural Gene ORF cDNA clone expression plasmid: General Information

Gene
Species
EBOV
RefSeq ORF Size
1350 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Partial length Clone DNA of Ebola virus EBOV (subtype Zaire, Guinea 2014) RNA polymerase L.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6.1kb + 1.35kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Ebola virus RNA polymerase L cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ebola virus EBOV (subtype Zaire, Guinea 2014) RNA polymerase L partial natural Gene ORF cDNA clone expression plasmid: Validated Images

Ebola virus RNA polymerase L cDNA ORF Clone, EBOV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.