Sino Biological - 공식 웹사이트

Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized)

Price:
Size:
Number:

Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): General Information

Gene
Species
H1N1
RefSeq ORF Size
1497 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with Q5UEW0.1.
Description
Full length Clone DNA of Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized): Alternative Names

NP cDNA ORF Clone, H1N1

Nucleocapsid/NP cDNA ORF Clone, H7N9, Related Products

Nucleocapsid/NP cDNA ORF Clone, H1N1, Related Products

Nucleocapsid/NP cDNA ORF Clone, Influenza B, Related Products

Nucleocapsid/NP cDNA ORF Clone, H9N2, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait