Influenza A H7N9 (A/Anhui/PA-1/2013) Matrix protein 2 / M2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag

Price:
Size:
Number:

Influenza A H7N9 (A/Anhui/PA-1/2013) Matrix protein 2 / M2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag: General Information

Gene
Species
H7N9
RefSeq ORF Size
294 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with KF768182.
Description
Full length Clone DNA of Influenza A H7N9 (A/Anhui/PA-1/2013) Matrix protein 2 DNA.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.