Hepatitis C virus (HCV-1a) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

Price:
Size:
Number:

Hepatitis C virus (HCV-1a) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged: General Information

Gene
Species
HCV
NCBI Ref Seq
RefSeq ORF Size
783 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence NC_004102.1 (5475..6257), corresponding to amino acid sequence NP_751926.1.
Description
Full length Clone DNA of Hepatitis C virus (HCV) (serotype 1a, isolate H77) NS4B with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.