HPV51 L1 Gene ORF cDNA clone expression plasmid (Codon Optimized)

1/1
Price:
Size:
Number:

HPV51 L1 Gene ORF cDNA clone expression plasmid (Codon Optimized): General Information

Gene
Species
HPV
RefSeq ORF Size
1515 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P26536.
Description
Full length Clone DNA of HPV51 major capsid protein L1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.52kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HPV capsid L1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HPV51 L1 Gene ORF cDNA clone expression plasmid (Codon Optimized): Validated Images

HPV capsid L1 Background Information

Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their hosts. Human papillomaviruses (HPVs) are associated with benign and malignant hyperproliferation of cells, with a wide variety of clinical manifestations ranging from condyloma acuminata to cervical carcinoma. HPV infection is the most common sexually transmitted disease. More than 4 HPV types so far identified are known to infect the genital tract. Genital HPVs are divided into `low risk' HPVs such as HPV 6 and 11 and ‘high risk’ HPV types such as 16, 18, 31, 33, 35, 39, 45 and 52, 58 which are responsible for more than 95% of HPV-induced cervical cancer. Vaccination against these high risk types seems to be the most feasible prevention for cervical cancer. Indeed, clinical trials have shown prophylactic HPV vaccines to be effective against HPV infection, cervical intraepithelial neoplasia (CIN), and genital warts, but protection is type-specific and the currently developed vaccines target only a few types. These vaccines are based on papillomavirus-like particles (VLPs) composed of the major capsid protein, L1. The L1 protein self assembles into VLPs when expressed at high levels in eukaryotic or insect cells. VLPs are composed of 36 copies of L1 protein organized into 72 pentamers, so called capsomeres, to form particles which are immunologically indistinguishable from native virions. Experimentally induced VLP antisera have been shown to be mostly typespecific with respect to neutralization. Minor cross-neutralization has been observed only between closely related HPV types, e.g. HPV6 and 11, HPV18 and 45, or HPV16 and 31. Structure analysis has revealed the presence of several hyper variable loops on the outer surface of the capsid. With a few exceptions, all HPV-neutralizing monoclonal antibodies analyzed so far are type-specific and recognize conformational epitopes within surface-exposed hyper variable loops of the major capsid protein L1.
References
  • Zur Hausen, H., 1989, Cancer Res. 49: 4677-4691.
  • Chan, SY, et al., 1995, J. Virol. 69: 3074-3083.
  • Lorincz AT, et al., 1992, Obstet Gynecol. 79: 328-337.
  • Munoz N, et al., 2003, N Engl J Med. 348: 518-527.
  • Pastrana DV, et al., 2004, Virology. 321: 205-216.
  • Christensen ND, et al., 1996, Virology. 224: 477-486.
  • Combita AL, et al., 2002, J Virol. 76: 6480-6486.
  • Christensen ND, et al., 2001, Virology. 291:324-334.
  • Fleury MJ, et al., Arch Virol. 2006, 151: 1511-1523.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.