A4GALT cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

A4GALT cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Description
Full length Clone DNA of Human alpha 1,4-galactosyltransferase with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

A4GALT cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

A14GALT cDNA ORF Clone, Human; A4GALT1 cDNA ORF Clone, Human; Gb3S cDNA ORF Clone, Human; P(k) cDNA ORF Clone, Human; P1 cDNA ORF Clone, Human; P1PK cDNA ORF Clone, Human; PK cDNA ORF Clone, Human

A4GALT Background Information

Full Name
alpha 1,4-galactosyltransferase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.