AKT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

AKT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1446 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens v-akt murine thymoma viral oncogene homolog 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

AKT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

HIHGHH cDNA ORF Clone, Human; PKBB cDNA ORF Clone, Human; PKBBETA cDNA ORF Clone, Human; PRKBB cDNA ORF Clone, Human; RAC-BETA cDNA ORF Clone, Human

AKT2 Background Information

AKT (AK mouse plus Transforming or Thymoma) is a frequent oncogene expressed in most tissues which includes three isoforms AKT1, AKT2, and AKT3. Hyperactivation of AKT signaling is a central key in many human cancer progressions, through modulating angiogenesis, tumor growth, and cell migration, invasion, metastasis, and chemoresistance. Among all three isoforms, AKT2 is most related to cancer cell invasion, metastasis, and survival. Amplification and overexpression of AKT2 have been shown in many cancers. Accumulating evidence shows the potential role of different miRNA involvements in cancer progression by activating or suppressing AKT2 expression. The AKT2/NAB1/SPK1 pathway is a novel regulating factor of macrophage migration and cardiac remodeling after myocardial infarction. The novel mechanism of the AKT2-PKM2-STAT3/NF-kappaB axis in the regulation of ovarian cancer progression, that both AKT2 and PKM2 may be potential targets for the treatment of ovarian cancer. AKT1 and AKT2, the AKT isoforms that are highly expressed in skeletal muscle, have distinct and overlapping functions, with AKT2 more important for insulin-stimulated glucose metabolism. In adipocytes, AKT2 versus AKT1 has greater susceptibility for insulin-mediated redistribution from cytosolic to membrane localization, and insulin also causes subcellular redistribution of AKT Substrate of 16 kDa (AS16), an AKT2 substrate and crucial mediator of insulin-stimulated glucose transport.
Full Name
v-akt murine thymoma viral oncogene homolog 2
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • p53 Pathway
    p53 Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • AMPK Signaling Pathway
    AMPK Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.