Sino Biological - 공식 웹사이트

ALK-7 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

ALK-7 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Human activin A receptor, type I C with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ALK-7 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ACVRLK7 cDNA ORF Clone, Human; ALK7 cDNA ORF Clone, Human

ALK-7 Background Information

ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.
Full Name
activin A receptor, type IC
References
  • Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. Nature. 482(7384):251-5.
  • He C, et al. (2010) A large-scale candidate gene association study of age at menarche and age at natural menopause. Hum Genet. 128(5):515-27.
  • Watanabe R, et al. (2008) Insulin gene is a target in activin receptor-like kinase 7 signaling pathway in pancreatic beta-cells. Biochem Biophys Res Commun. 377(3):867-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait