C3a Receptor cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

C3a Receptor cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1449 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human complement component 3a receptor 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.45kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C3a Receptor cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C3a Receptor cDNA ORF Clone, Human, untagged: Validated Images

C3a Receptor cDNA ORF Clone, Human, untagged: Synonyms

AZ3B cDNA ORF Clone, Human; C3AR cDNA ORF Clone, Human; HNFAG09 cDNA ORF Clone, Human

C3a Receptor Background Information

Full Name
complement component 3a receptor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.