C7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

C7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2532 bp
Description
Full length Clone DNA of Human complement component 7 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

C7 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

Complement C7 cDNA ORF Clone, Human

C7 Background Information

Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family. It contains 1 EGF-like domain, 1 LDL-receptor class A domain, 1 MACPF domain, 2 Sushi (CCP/SCR) domains and 2 TSP type-1 domains. Complement component 7 serves as a membrane anchor. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. It is a constituent of MAC that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C7 are a cause of complement component 7 deficiency (C7D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis.
Full Name
complement component 7
Related Pathways
  • Complement Activation Pathways
    Complement Activation Pathways
References
  • Bossi F, et al. (2009) C7 is expressed on endothelial cells as a trap for the assembling terminal complement complex and may exert anti-inflammatory function. Blood. 113(15):3640-8.
  • Kuijpers TW, et al. (2010) Complement factor 7 gene mutations in relation to meningococcal infection and clinical recurrence of meningococcal disease. Mol Immunol. 47(4):671-7.
  • Thomas AD, et al. (2012) Characterization of a large genomic deletion in four Irish families with C7 deficiency. Mol Immunol. 50(1-2):57-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.