CaMKII/CAMK2G cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

CaMKII/CAMK2G cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1557 bp
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CaMKII/CAMK2G cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

CAMK cDNA ORF Clone, Human; CAMK-II cDNA ORF Clone, Human; CAMKG cDNA ORF Clone, Human

CaMKII/CAMK2G Background Information

Full Name
calcium/calmodulin-dependent protein kinase II gamma
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.