CaMKII/CAMK2G cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

CaMKII/CAMK2G cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 186G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.6kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CaMKII/CAMK2G cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CaMKII/CAMK2G cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Validated Images

CaMKII/CAMK2G cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

CAMK cDNA ORF Clone, Human; CAMK-II cDNA ORF Clone, Human; CAMKG cDNA ORF Clone, Human

CaMKII/CAMK2G Background Information

Full Name
calcium/calmodulin-dependent protein kinase II gamma
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.