Carbonic Anhydrase VII cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Carbonic Anhydrase VII cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human carbonic anhydrase VII with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Carbonic Anhydrase VII cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CAVII cDNA ORF Clone, Human

Carbonic Anhydrase VII Background Information

Carbonic anhydrase 7, also known as carbonate dehydratase VII, carbonic anhydrase VII, CA-VII and CA7, is a cytoplasm protein which belongs to thealpha-carbonic anhydrase family. Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases show extensive diversity in tissue distribution and in their subcellular localization. CA7 / CA-VII is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms.
Full Name
carbonic anhydrase VII
References
  • Montgomery J.C., et al., 1991, Genomics 11:835-848.
  • Temperini C., et al., 2006, Chemistry 12:7057-7066.
  • Temperini C., et al., 2007, Bioorg. Med. Chem. Lett. 17:628-635.
  • Maresca A., et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.