Carbonic Anhydrase VII Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Carbonic Anhydrase VII Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens carbonic anhydrase VII.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Carbonic Anhydrase VII Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CAVII cDNA ORF Clone, Human

Carbonic Anhydrase VII Background Information

Carbonic anhydrase 7, also known as carbonate dehydratase VII, carbonic anhydrase VII, CA-VII and CA7, is a cytoplasm protein which belongs to thealpha-carbonic anhydrase family. Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases show extensive diversity in tissue distribution and in their subcellular localization. CA7 / CA-VII is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms.
Full Name
carbonic anhydrase VII
References
  • Montgomery J.C., et al., 1991, Genomics 11:835-848.
  • Temperini C., et al., 2006, Chemistry 12:7057-7066.
  • Temperini C., et al., 2007, Bioorg. Med. Chem. Lett. 17:628-635.
  • Maresca A., et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.