Caspase-3 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

Caspase-3 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Human caspase 3, apoptosis-related cysteine peptidase (CASP3), transcript variant alpha with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Caspase-3 cDNA ORF Clone, Human, N-HA tag: Synonyms

CPP32 cDNA ORF Clone, Human; CPP32B cDNA ORF Clone, Human; SCA-1 cDNA ORF Clone, Human

Caspase-3 Background Information

Full Name
caspase 3, apoptosis-related cysteine peptidase
Research Areas
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • p53 Pathway
    p53 Pathway
  • TNF Signaling
    TNF Signaling
  • IL17 signaling pathway
    IL17 signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.