CCL25/TECK cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

CCL25/TECK cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
453 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation: 408 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 25.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 0.45kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL25/TECK cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL25/TECK cDNA ORF Clone, Human, untagged: Validated Images

CCL25/TECK cDNA ORF Clone, Human, untagged: Alternative Names

Ckb15 cDNA ORF Clone, Human; SCYA25 cDNA ORF Clone, Human; TECK cDNA ORF Clone, Human

CCL25/TECK Background Information

Full Name
chemokine (C-C motif) ligand 25
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait