CCL5/RANTES cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

CCL5/RANTES cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
276 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 5 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL5/RANTES cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

D17S136E cDNA ORF Clone, Human; eoCP cDNA ORF Clone, Human; RANTES cDNA ORF Clone, Human; SCYA5 cDNA ORF Clone, Human; SIS-delta cDNA ORF Clone, Human; SISd cDNA ORF Clone, Human; TCP228 cDNA ORF Clone, Human

CCL5/RANTES Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 5(CCL5) is chemotactic for T cells, basophils and eosinophils. Chemokin ligand 5(CCL5) has been considered a HIV-supressor secreted by CD8+ T cells and other immune cells. Chemokin ligand 5(CCL5) is a key to activating recruit leukocytes into inflammatory sites and in the presence of particular cytokines released by T cells, it can change the NK cells into CHAK cells.
Full Name
chemokine (C-C motif) ligand 5
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Vangelista L, et al. (2010) Engineering of Lactobacillus jensenii to secrete RANTES and a CCR5 antagonist analogue as live HIV-1 blockers. Antimicrob. Agents Chemother. 54 (7): 2994-3001.
  • Maghazachi AA, et al. (1996) CC chemokines induce the generation of killer cells from CD56+ cells. Eur. J. Immunol. 26 (2): 315-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait