CD21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

CD21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3831 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens complement component (3d/Epstein Barr virus) receptor 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI(four restriction sites) + NotI(6.54kb+0.14kb+0.03kb+1.91kb+1.78kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD21 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

CD21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

C3DR cDNA ORF Clone, Human; CD21 cDNA ORF Clone, Human; CR cDNA ORF Clone, Human; CVID7 cDNA ORF Clone, Human; SLEB9 cDNA ORF Clone, Human

CD21 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD21, also known as Complement component (3d / Epstein Barr virus) receptor 2 and CR2, is a member of the CD system and is a protein involved in complement system. CD21 is present on all mature B-cells and some T-cells and follicular dendritic cells. CD21 on mature B-cells form a complex called the B cell receptor complex with two other membrane proteins, CD19 and CD81. CD21 has a function in the complement system through serving as the cellular receper specific for ligands such as C3 and C4 which can be attached to foreign macromolecules in order to remove or uptake them. This results in B-cells having enhanced response to the antigen.
Full Name
complement component (3d/Epstein Barr virus) receptor 2
Related Pathways
  • Complement Activation Pathways
    Complement Activation Pathways
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Joseph M, et al. (1989) Structure and Function of the Complement Receptors, CR1 (CD35) and CR2 (CD21). Advanced in immunology. 46: 183-219.
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature 358: 505 - 7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.