CDC37 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

CDC37 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens cell division cycle 37 homolog (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CDC37 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

P50CDC37 cDNA ORF Clone, Human

CDC37 Background Information

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp9. Decreased Hsp9 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp9's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.
Full Name
cell division cycle 37
Related Pathways
  • AKT Signaling Pathway
    AKT Signaling Pathway
References
  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.