CDK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

CDK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens cyclin-dependent kinase 7.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CDK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CAK1 cDNA ORF Clone, Human; CDKN7 cDNA ORF Clone, Human; HCAK cDNA ORF Clone, Human; MO15 cDNA ORF Clone, Human; p39MO15 cDNA ORF Clone, Human; STK1 cDNA ORF Clone, Human

CDK7 Background Information

Full Name
cyclin-dependent kinase 7
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.