CDK7 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

CDK7 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Human cyclin-dependent kinase 7 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDK7 cDNA ORF Clone, Human, N-His tag: Synonyms

CAK1 cDNA ORF Clone, Human; CDKN7 cDNA ORF Clone, Human; HCAK cDNA ORF Clone, Human; MO15 cDNA ORF Clone, Human; p39MO15 cDNA ORF Clone, Human; STK1 cDNA ORF Clone, Human

CDK7 Background Information

Full Name
cyclin-dependent kinase 7
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.