CRTAM cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

CRTAM cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Human cytotoxic and regulatory T cell molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CRTAM cDNA ORF Clone, Human, C-HA tag: Synonyms

CD355 cDNA ORF Clone, Human

CRTAM Background Information

Cytotoxic and regulatory T-cell molecule, also known as Class-I MHC-restricted T-cell-associated molecule and CRTAM, is a single-pass type I membrane protein which belongs to thenectin family.CRTAM contains oneIg-like C2-type (immunoglobulin-like) domain and oneIg-like V-type (immunoglobulin-like) domain. In the immune system, the expression of CRTAM is restricted to activated class-I MHC-restricted cells, including NKT and CD8 cells. It is strongly expressed in spleen, thymus, small intestine, peripheral blood leukocyte, and in purkinje neurons in cerebellum. It is expressed at much lower levels in testis, ovary, colon, lung and lymphoid tissues. CRTAM is a member of the immunoglobulin superfamily that complies with the structural characteristics of the JAM family of proteins and is phylogenetically more closely related to nectin-like proteins. It is a molecule involved in epithelial cell adhesion. CRTAM is sensitive to intermediate filament disruption and treatment of monolayers with soluble CRTAM enhances cell-cell dissociation and lowers transepithelial electrical resistance. CRTAM may also induce retention by binding to CD8+ dendritic cells (DCs) at the late stage of activation before proliferation.
Full Name
cytotoxic and regulatory T cell molecule
References
  • Garay, E. et al., 2010, J Cell Biochem. 111 (1):111-22.
  • Medina-C.O. et al., 2010, Dev Comp Immunol. 34 (2):196-202.
  • Takeuchi, A. et al., 2009, J Immunol.183 (7):4220-8.
  • Valle-Rios,R. et al., 2009, Mol Immunol. 46 (16): 3379-87.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.