CXCR4/CD184 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

CXCR4/CD184 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1071 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-X-C motif) receptor 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.12kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCR4/CD184 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR4/CD184 cDNA ORF Clone, Human, N-Myc tag: Validated Images

CXCR4/CD184 cDNA ORF Clone, Human, N-Myc tag: Synonyms

CD184 cDNA ORF Clone, Human; D2S201E cDNA ORF Clone, Human; FB22 cDNA ORF Clone, Human; HM89 cDNA ORF Clone, Human; HSY3RR cDNA ORF Clone, Human; LAP-3 cDNA ORF Clone, Human; LAP3 cDNA ORF Clone, Human; LCR1 cDNA ORF Clone, Human; LESTR cDNA ORF Clone, Human; NPY3R cDNA ORF Clone, Human; NPYR cDNA ORF Clone, Human; NPYRL cDNA ORF Clone, Human; NPYY3R cDNA ORF Clone, Human; WHIM cDNA ORF Clone, Human; WHIMS cDNA ORF Clone, Human

CXCR4/CD184 Background Information

Full Name
chemokine (C-X-C motif) receptor 4
Related Pathways
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • Autophagy Pathway
    Autophagy Pathway

CXCR4/CD184 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.