Eotaxin/CCL11 cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Eotaxin/CCL11 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
294 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 11 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Eotaxin/CCL11 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

SCYA11 cDNA ORF Clone, Human

Eotaxin/CCL11 Background Information

CCL11 or chemokine (C-C motif) ligand 11 is a member of the chemokine (C-C motif) ligand family. Chemokin (C-C motif) ligand 11 is a member of the chemokine family. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. They share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. CCL11 is implicated in allergic responses through selectively recruiting eosinophils by inducing their chemotaxis. The effects of CCL11 are mediated by its binding to chemokine receptor. Increased CCL11 levels in blood plasma are associated with aging in mice.
Full Name
chemokine (C-C motif) ligand 11
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Coc-chi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Villeda SA, et al. (2011) The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature. 477: 90-4.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait