FHL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

FHL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
843 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens four and a half LIM domains 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

FHL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

FHL-1 cDNA ORF Clone, Human; FHL1A cDNA ORF Clone, Human; FHL1B cDNA ORF Clone, Human; FLH1A cDNA ORF Clone, Human; KYOT cDNA ORF Clone, Human; SLIM cDNA ORF Clone, Human; SLIM-1 cDNA ORF Clone, Human; SLIM1 cDNA ORF Clone, Human; SLIMMER cDNA ORF Clone, Human; XMPMA cDNA ORF Clone, Human

FHL1 Background Information

Full Name
four and a half LIM domains 1

FHL1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.