GPR182 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

GPR182 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human G protein-coupled receptor 182
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.25kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

GPR182 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About GPR182

Entrez Gene ID

GPR182 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

GPR182 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

7TMR cDNA ORF Clone, Human; ADMR cDNA ORF Clone, Human; AM-R cDNA ORF Clone, Human; AMR cDNA ORF Clone, Human; G10D cDNA ORF Clone, Human; gamrh cDNA ORF Clone, Human; hrhAMR cDNA ORF Clone, Human

GPR182 Background Information

Full Name
G protein-coupled receptor 182
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.