HMGB1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

HMGB1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 633T/C,636T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human high mobility group box 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.70kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

HMGB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGB1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

HMGB1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

HMG-1 cDNA ORF Clone, Human; HMG1 cDNA ORF Clone, Human; HMG3 cDNA ORF Clone, Human; SBP-1 cDNA ORF Clone, Human

HMGB1 Background Information

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2, and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis are present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription, and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal " necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of the rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. Besides, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.
Full Name
high mobility group box 1
Related Pathways
  • Autophagy Pathway
    Autophagy Pathway
References
  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.
  • HMGB1/TNFR1/NF-κB Axis in Prostate cancer: Clinical and Biological Correlation
    Author
    Jung, AR;Kim, GE;Kim, MY;Ha, US;Hong, SH;Lee, JY;
    Year
    2020
    Journal
    Research Square
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.