ICAM4 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ICAM4 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
819 bp
Description
Full length Clone DNA of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)? with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ICAM4 cDNA ORF Clone, Human, N-His tag: Synonyms

CD242 cDNA ORF Clone, Human; LW cDNA ORF Clone, Human

ICAM4 Background Information

ICAM4, also known as CD242, is a member of the?immunoglobulin superfamily, ICAM family. ICAM4 contains 2?Ig-like C2-type (immunoglobulin-like) domains. It is similar to the intercellular adhesion molecule (ICAM) protein family. ICAM4 binds to the leukocyte adhesion LFA-1 protein. ICAM4's first reported receptors were CD11a/CD18 and CD11b/CD18. ICAM4 functions as a ligand for the monocyte/macrophage-specific CD11c/CD18. Deletion of the individual immunoglobulin domains of ICAM4 demonstrated that both its domains contain binding sites for CD11c/CD18. CD11c/CD18 is expressed on macrophages in spleen and bone marrow. Inhibition of erythrophagocytosis by anti-ICAM4 and anti-integrin antibodies suggests a role for these interactions in removal of senescent red cells.
Full Name
intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway
References
  • Gorst DW. et al., 1980, Vox Sanguinis. 38 (2): 99-105.
  • Vos GH. et al., 1973, Blood. 42 (3): 445-53.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Daniels G. et al., 2002, Transfusion Medicine. 12 (5): 287-95.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.