Sino Biological - 공식 웹사이트

IL1RL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

IL1RL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1728 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens interleukin 1 receptor-like 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL1RL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

IL-1Rrp2 cDNA ORF Clone, Human; IL-36R cDNA ORF Clone, Human; IL1R-rp2 cDNA ORF Clone, Human; IL1RRP2 cDNA ORF Clone, Human

IL1RL2 Background Information

The IL36 receptor (IL1RL2) is an important mediator molecule in the inflammatory response. Animal data suggests that IL1RL2 is involved in mucosal healing. Therapeutic intervention of IL-36R signaling offers an innovative treatment paradigm for targeting epithelial cell-mediated inflammatory diseases such as the life-threatening psoriasis variant called generalized pustular psoriasis (GPP).
Full Name
interleukin 1 receptor like 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait