Sino Biological - 공식 웹사이트

IL20RA cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

IL20RA cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1662 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 20 receptor, alpha (IL20RA).
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.66kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL20RA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL20RA cDNA ORF Clone, Human, untagged: Validated Images

IL20RA cDNA ORF Clone, Human, untagged: Alternative Names

CRF2-8 cDNA ORF Clone, Human; IL-20R-alpha cDNA ORF Clone, Human; IL-20R1 cDNA ORF Clone, Human; IL-20RA cDNA ORF Clone, Human

IL20RA Background Information

Interleukin 2 receptor, alpha subunit (IL2RA/IL-2RA) also known as IL-2 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-2 receptor I, and interleukin-2 receptor subunit alpha, is a subunit for the interleukin-2 receptor. IL2RA/IL-2RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 2 (IL2), a cytokine that may be involved in epidermal function. The receptor of IL2 is a heterodimeric receptor complex consisting of this protein and interleukin 2 receptor beta (IL2B). IL2RA forms heterodimer with IL2RB, and the complex serves as a receptor for IL19, IL2 and IL24. All three are capable of signaling through IL-2RA/IL-2RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL2RA also forms a heterodimer with the unique and specific receptor IL1RB and functions as the receptor for IL26. IL2RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL2RA and IL2RB is found to be upregulated in psoriatic skin lesions on keratinocytes.
Full Name
interleukin 20 receptor, alpha
References
  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.

IL20RA cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait