IP-10/CXCL10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

IP-10/CXCL10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IP-10/CXCL10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

C7 cDNA ORF Clone, Human; crg-2 cDNA ORF Clone, Human; gIP-10 cDNA ORF Clone, Human; IFI10 cDNA ORF Clone, Human; INP10 cDNA ORF Clone, Human; IP-10 cDNA ORF Clone, Human; mob-1 cDNA ORF Clone, Human; SCYB10 cDNA ORF Clone, Human

IP-10/CXCL10 Background Information

(C-X-C motif) ligand (CXCL)10 (CXCL10) belongs to the ELR(-) CXC subfamily chemokine. CXCL10/IP-10 exerts its function through binding to chemokine (C-X-C motif) receptor 3 (CXCR3), a seven trans-membrane receptor coupled to G proteins. CXCL10/IP-10 and its receptor, CXCR3, appear to contribute to the pathogenesis of many autoimmune diseases, organ specific (such as type 1 diabetes, autoimmune thyroiditis, Graves' disease and ophthalmopathy), or systemic (such as rheumatoid arthritis, psoriatic arthritis, systemic lupus erythematosus, mixed cryoglobulinemia, Sjögren syndrome, or systemic sclerosis). CXCL10/IP-10 is secreted by several cell types including endothelial cells, fibroblasts, keratinocytes, thyrocytes, preadipocytes, etc. Determination of high level of CXCL10/IP-10 in peripheral fluids is therefore a marker of host immune response.
Full Name
chemokine (C-X-C motif) ligand 10
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.