IP-10/CXCL10 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

IP-10/CXCL10 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 10 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IP-10/CXCL10 cDNA ORF Clone, Human, N-Myc tag: Synonyms

C7 cDNA ORF Clone, Human; crg-2 cDNA ORF Clone, Human; gIP-10 cDNA ORF Clone, Human; IFI10 cDNA ORF Clone, Human; INP10 cDNA ORF Clone, Human; IP-10 cDNA ORF Clone, Human; mob-1 cDNA ORF Clone, Human; SCYB10 cDNA ORF Clone, Human

IP-10/CXCL10 Background Information

(C-X-C motif) ligand (CXCL)10 (CXCL10) belongs to the ELR(-) CXC subfamily chemokine. CXCL10/IP-10 exerts its function through binding to chemokine (C-X-C motif) receptor 3 (CXCR3), a seven trans-membrane receptor coupled to G proteins. CXCL10/IP-10 and its receptor, CXCR3, appear to contribute to the pathogenesis of many autoimmune diseases, organ specific (such as type 1 diabetes, autoimmune thyroiditis, Graves' disease and ophthalmopathy), or systemic (such as rheumatoid arthritis, psoriatic arthritis, systemic lupus erythematosus, mixed cryoglobulinemia, Sjögren syndrome, or systemic sclerosis). CXCL10/IP-10 is secreted by several cell types including endothelial cells, fibroblasts, keratinocytes, thyrocytes, preadipocytes, etc. Determination of high level of CXCL10/IP-10 in peripheral fluids is therefore a marker of host immune response.
Full Name
chemokine (C-X-C motif) ligand 10
Research Areas
Related Pathways
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.