LAMP1 cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

LAMP1 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 G>T and 556 C>A not causing the amino acid variation.
Description
Full length Clone DNA of Human lysosomal-associated membrane protein 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.94kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LAMP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAMP1 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

LAMP1 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

CD107a cDNA ORF Clone, Human; LAMPA cDNA ORF Clone, Human; LGP120 cDNA ORF Clone, Human

LAMP1 Background Information

Lysosome-associated membrane glycoprotein 1, also known as CD17 antigen-like family member A, CD17a, and LAMP1, is a single-pass type I membrane protein which belongs to the LAMP family. CD17a is expressed largely in the endosome-lysosome membranes of cells, but is also found on the plasma membrane (1-2% of total LAMP1). LAMP1 has been implicated in a variety of cellular functions, including cancer metastasis. It has been proposed LAMP1 serves as a therapeutic agent for some cancers, as well as a marker for lysosomal storage disorders and different cell types such as cytotoxic T cells. LAMP2, also known as CD17b, may also play a role in tumor cell metastasis and functions in the protection, maintenance, and adhesion of the lysosome. Cell surface LAMP1 and LAMP2 have been shown to promote adhesion of human peripheral blood mononuclear cells (PBMC) to vascular endothelium, therefore they are possibly involved in the adhesion of PBMCs to the site of inflammation. LAMP-1 is a glycoprotein highly expressed in lysosomal membranes. The present study was initiated to test LAMP-1 mRNA and protein levels in post mortem frontal cortex (area 8) of Alzheimer's disease (AD) stages I-IIA/B and stages V-VIC of Braak and Braak, compared with age-matched controls. LAMP-1 occurred in microglia and multinucleated giant cells in one AD case in whom amyloid burden was cleared following betaA-peptide immunization. In addition, LAMP-1 has been suggested to be a cell surface receptor for a specific amelogenin isoform, leucine-rich amelogenin peptide or LRAP. LAMP-1 can serve as a cell surface binding site for amelogenin on dental follicle cells and cementoblasts.
Full Name
lysosomal-associated membrane protein 1
References
  • Parkinson-Lawrence EJ, et al. (2005) Immunochemical analysis of CD107a (LAMP-1). Cell Immunol. 236(1-2): 161-6.
  • Barrachina M, et al. (2006) Lysosome-associated membrane protein 1 (LAMP-1) in Alzheimer's disease. Neuropathol Appl Neurobiol. 32(5): 505-16.
  • Zhang H, et al. (2010) Full length amelogenin binds to cell surface LAMP-1 on tooth root/periodontium associated cells. Arch Oral Biol. 55(6): 417-25.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait