MAPK15 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

MAPK15 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
873 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase 15 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI(6kb+0.87kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

MAPK15 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAPK15 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

MAPK15 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

ERK7 cDNA ORF Clone, Human; ERK8 cDNA ORF Clone, Human

MAPK15 Background Information

Full Name
mitogen-activated protein kinase 15
Related Pathways
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.