MS4A2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

MS4A2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
774 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human membrane-spanning 4-domains, subfamily A, member 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.77kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

MS4A2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About MS4A2

Entrez Gene ID

MS4A2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

MS4A2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

APY cDNA ORF Clone, Human; ATOPY cDNA ORF Clone, Human; FCER1B cDNA ORF Clone, Human; FCERI cDNA ORF Clone, Human; IGEL cDNA ORF Clone, Human; IGER cDNA ORF Clone, Human; IGHER cDNA ORF Clone, Human; MS4A1 cDNA ORF Clone, Human

MS4A2 Background Information

Full Name
membrane-spanning 4-domains, subfamily A, member 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.