MS4A2 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

MS4A2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human membrane-spanning 4-domains, subfamily A, member 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About MS4A2

Entrez Gene ID

MS4A2 cDNA ORF Clone, Human, untagged: Synonyms

APY cDNA ORF Clone, Human; ATOPY cDNA ORF Clone, Human; FCER1B cDNA ORF Clone, Human; FCERI cDNA ORF Clone, Human; IGEL cDNA ORF Clone, Human; IGER cDNA ORF Clone, Human; IGHER cDNA ORF Clone, Human; MS4A1 cDNA ORF Clone, Human

MS4A2 Background Information

Full Name
membrane-spanning 4-domains, subfamily A, member 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.