Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Myelin Oligodendrocyte Glycoprotein cDNA ORF Clone, Human, N-HA tag: Synonyms

BTN6 cDNA ORF Clone, Human; BTNL11 cDNA ORF Clone, Human; MOGIG2 cDNA ORF Clone, Human; NRCLP7 cDNA ORF Clone, Human

Myelin Oligodendrocyte Glycoprotein Background Information

Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to the immunoglobulin superfamily and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in the oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce demyelinating multiple sclerosis-like diseases in experimental animals.
Full Name
myelin oligodendrocyte glycoprotein
References
  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.