NPC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

NPC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
456 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens Niemann-Pick disease, type C2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

NPC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

EDDM1 cDNA ORF Clone, Human; HE1 cDNA ORF Clone, Human

NPC2 Background Information

Niemann-Pick Type C2 (NPC2) plays an important role in the regulation of intracellular cholesterol homeostasis via direct binding with free cholesterol. NPC2 is an intralysosomal protein that binds cholesterol in vitro. NPC2 is a small lysosomal glycoprotein that binds cholesterol with submicromolar affinity. Deficiency in NPC2 is the cause of Niemann-Pick type C2 disease, a fatal neurovisceral disorder characterized by the accumulation of cholesterol in lysosomes. Niemann-Pick disease, type C2 (NPC2) protein is one of the most abundant components of the epididymal fluid and contains a functional cholesterol-binding site that can transfer cholesterol between membranes, it has been suggested for years that NPC2 could be involved in the regulation of cholesterol levels in spermatozoa during epididymal maturation.
Full Name
Niemann-Pick disease, type C2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.