NPC2 cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

NPC2 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1143 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Niemann-Pick disease, type C2 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.14kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NPC2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NPC2 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

NPC2 cDNA ORF Clone, Human, C-OFPSpark® tag: Synonyms

EDDM1 cDNA ORF Clone, Human; HE1 cDNA ORF Clone, Human

NPC2 Background Information

Niemann-Pick Type C2 (NPC2) plays an important role in the regulation of intracellular cholesterol homeostasis via direct binding with free cholesterol. NPC2 is an intralysosomal protein that binds cholesterol in vitro. NPC2 is a small lysosomal glycoprotein that binds cholesterol with submicromolar affinity. Deficiency in NPC2 is the cause of Niemann-Pick type C2 disease, a fatal neurovisceral disorder characterized by the accumulation of cholesterol in lysosomes. Niemann-Pick disease, type C2 (NPC2) protein is one of the most abundant components of the epididymal fluid and contains a functional cholesterol-binding site that can transfer cholesterol between membranes, it has been suggested for years that NPC2 could be involved in the regulation of cholesterol levels in spermatozoa during epididymal maturation.
Full Name
Niemann-Pick disease, type C2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.