OXCT1 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

OXCT1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1563 bp
Description
Full length Clone DNA of Human 3-oxoacid CoA transferase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

OXCT1 cDNA ORF Clone, Human, N-His tag: Synonyms

OXCT cDNA ORF Clone, Human; SCOT cDNA ORF Clone, Human

OXCT1 Background Information

Succinyl-CoA:3-oxoacid CoA transferase (SCOT, gene symbol OXCT1) deficiency is an autosomal recessive disorder in ketone body utilization that results in severe recurrent ketoacidosis episodes in infancy, including neonatal periods. 3-oxoacid CoA-transferase 1 (OXCT1) is a key enzyme in ketone body metabolism that catalyzes the first and rate-determining step of ketolysis and is expressed in adipose and other tissues. The product of OXCT1 converts to acetyl-CoA and finally fed into the tricarboxylic acid cycle for oxidation and ATP production. In the mitochondrial matrix, the OXCT1 gene catalyzes the reversible transfer of coenzyme A from succinyl-CoA to acetoacetate in a reaction related to energy production from ketone bodies. OXCT1 may play a role in adipogenesis and provides new insight on adipose deposition in sheep.
Full Name
3-oxoacid CoA transferase 1
References
  • Zhang S, et al. (2017) The role of oxct1 in the pathogenesis of cancer as a rate-limiting enzyme of ketone body metabolism. Life Sci 183 110-115.
  • Sasai H, et al. (2017) Heterozygous carriers of succinyl-coa:3-oxoacid coa transferase deficiency can develop severe ketoacidosis. J Inherit Metab Dis 40 (6): 845-852.
  • Nam GH, et al. (2012) Identification of orf sequences and exercise-induced expression change in thoroughbred horse oxct1 gene. Gene 496 (1): 45-48.

OXCT1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.