P38 Gamma/MAPK12 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

P38 Gamma/MAPK12 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 183T/C,603T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human mitogen-activated protein kinase 12
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
HindIII + NotI(6.1kb+1.07kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

P38 Gamma/MAPK12 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

P38 Gamma/MAPK12 cDNA ORF Clone, Human, untagged: Validated Images

P38 Gamma/MAPK12 cDNA ORF Clone, Human, untagged: Synonyms

ERK-6 cDNA ORF Clone, Human; ERK3 cDNA ORF Clone, Human; ERK6 cDNA ORF Clone, Human; MAPK12 cDNA ORF Clone, Human; P38GAMMA cDNA ORF Clone, Human; PRKM12 cDNA ORF Clone, Human; SAPK-3 cDNA ORF Clone, Human; SAPK3 cDNA ORF Clone, Human

P38 Gamma/MAPK12 Background Information

ERK3, also known as MAPK12 and p38-gamma, belongs to theprotein kinase superfamily, CMGC Ser/Thr protein kinase family and MAP kinase subfamily. ERK3 is highly expressed in skeletal muscle and heart.ERK3 is a serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK12 is one of the four p38 MAPKs which play an important role in the cascades of cellular responses evoked by extracellular stimuli such as proinflammatory cytokines or physical stress leading to direct activation of transcription factors such as ELK1 and ATF2. Accordingly, p38 MAPKs phosphorylate a broad range of proteins and it has been estimated that they may have approximately 2 to 3 substrates each. MAPK12 is required for the normal kinetochore localization of PLK1, prevents chromosomal instability and supports mitotic cell viability. MAPK12-signaling is also positively regulating the expansion of transient amplifying myogenic precursor cells during muscle growth and regeneration.
Full Name
mitogen-activated protein kinase 12
Related Pathways
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Stiffler MA. et al., 2006, J Am Chem Soc. 128 (17): 5913-22.
  • Joneson T. et al., 1997, J Mol Med. 75 (8): 587-93.
  • Hou SW. et al., 2010, Cancer Res. 70 (7): 2901-10.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.