p38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

p38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 14, transcript variant 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

p38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CSBP cDNA ORF Clone, Human; CSBP1 cDNA ORF Clone, Human; CSBP2 cDNA ORF Clone, Human; CSPB1 cDNA ORF Clone, Human; EXIP cDNA ORF Clone, Human; Mxi2 cDNA ORF Clone, Human; p38 cDNA ORF Clone, Human; p38ALPHA cDNA ORF Clone, Human; PRKM14 cDNA ORF Clone, Human; PRKM15 cDNA ORF Clone, Human; RK cDNA ORF Clone, Human; SAPK2A cDNA ORF Clone, Human

p38 Background Information

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. MAPK14 can be detected in the brain, heart, placenta, pancreas, and skeletal muscle and it is expressed to a lesser extent in the lung, liver, and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress-related transcription and cell cycle regulation, as well as in genotoxic stress response. In response to activation by environmental stress, pro-inflammatory cytokines, and lipopolysaccharide, MAPK14 phosphorylates some transcription factors, such as ELK1 and ATF2, and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example, IL-6. It may play a role in the stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.
Full Name
mitogen-activated protein kinase 14
Related Pathways
  • Non-Canonical Wnt Pathway
    Non-Canonical Wnt Pathway
  • p53 Pathway
    p53 Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • TNF Signaling
    TNF Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
  • IL1 signaling pathway
    IL1 signaling pathway
  • IL17 signaling pathway
    IL17 signaling pathway
References
  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.

p38 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.