Protein S/PROS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Protein S/PROS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2031 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens protein S (alpha).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Protein S/PROS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

PROS cDNA ORF Clone, Human; Protein S cDNA ORF Clone, Human; PS21 cDNA ORF Clone, Human; PS22 cDNA ORF Clone, Human; PS23 cDNA ORF Clone, Human; PS24 cDNA ORF Clone, Human; PS25 cDNA ORF Clone, Human; PSA cDNA ORF Clone, Human; THPH5 cDNA ORF Clone, Human; THPH6 cDNA ORF Clone, Human

Protein S/PROS1 Background Information

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.
Full Name
protein S (alpha)
References
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.