Protein S/PROS1 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

Protein S/PROS1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2052 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein S (alpha) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI(6kb+2.05kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Protein S/PROS1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Protein S/PROS1 cDNA ORF Clone, Human, N-Myc tag: Validated Images

Protein S/PROS1 cDNA ORF Clone, Human, N-Myc tag: Synonyms

PROS cDNA ORF Clone, Human; Protein S cDNA ORF Clone, Human; PS21 cDNA ORF Clone, Human; PS22 cDNA ORF Clone, Human; PS23 cDNA ORF Clone, Human; PS24 cDNA ORF Clone, Human; PS25 cDNA ORF Clone, Human; PSA cDNA ORF Clone, Human; THPH5 cDNA ORF Clone, Human; THPH6 cDNA ORF Clone, Human

Protein S/PROS1 Background Information

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.
Full Name
protein S (alpha)
References
  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.