RELT/TNFRSF19L cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

RELT/TNFRSF19L cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Human RELT tumor necrosis factor receptor with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RELT/TNFRSF19L cDNA ORF Clone, Human, N-HA tag: Alternative Names

TNFRSF19L cDNA ORF Clone, Human; TRLT cDNA ORF Clone, Human

RELT/TNFRSF19L Background Information

Receptor expressed in lymphoid tissues (RELT), also known as tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1. RELT/TNFRSF19L is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. RELT/TNFRSF19L is a type I transmembrane glycoprotein with a cysteine-rich extracellular domain, possessing significant homology to other members of the TNFR superfamily, especially TNFRSF19, DR3, OX4, and LTbeta receptor. RELT/TNFRSF19L is able to activate the NF-kappaB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. RELT/TNFRSF19L is able to activate the NF-κB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. Although the soluble form of RELT fusion protein does not inhibit the one-way mixed lymphocyte reaction, immobilized RELT/TNFRSF19L is capable of costimulating T-cell proliferation in the presence of CD3 signaling.
Full Name
RELT tumor necrosis factor receptor
References
  • Sica GL, et al. (2001) RELT, a new member of the tumor necrosis factor receptor superfamily, is selectively expressed in hematopoietic tissues and activates transcription factor NF-kappaB. Blood. 97(9): 2702-7.
  • Polek TC, et al. (2006) The TNF receptor, RELT, binds SPAK and uses it to mediate p38 and JNK activation. Biochem Biophys Res Commun. 343(1): 125-34.
  • Cusick JK, et al. (2006) Identification of RELT homologues that associate with RELT and are phosphorylated by OSR1. Biochem Biophys Res Commun. 340(2): 535-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait