STAT6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

STAT6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2583 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human signal transducer and activator of transcription 6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.58kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

STAT6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Validated Images

STAT6 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

D12S1644 cDNA ORF Clone, Human; IL-4-STAT cDNA ORF Clone, Human; STAT6B cDNA ORF Clone, Human; STAT6C cDNA ORF Clone, Human

STAT6 Background Information

Signal transducer and activator of transcription 6 (STAT6) is a transcription factor that is activated by interleukin-4 (IL-4)-induced tyrosine phosphorylation and mediates most of the IL-4-induced gene expression. STAT6 plays a central role in exerting interleukin-4 (IL-4) mediated biological responses and is found to induce the expression of BCL2L1/BCL-XL, which is responsible for the anti-apoptotic activity of IL4. Transcriptional activation by STAT6 requires the interaction with coactivators like p3 and the CREB-binding protein (CBP). NF-?B and tyrosine-phosphorylated Stat6 can directly bind each other in vitro and in vivo, which suggest that the direct interaction between Stat6 and NF-?B may provide a basis for synergistic activation of transcription by IL-4 and activators of NF-?B.
Full Name
signal transducer and activator of transcription 6, interleukin-4 induced
Related Pathways
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
References
  • Litterst CM, et al. (2001) Transcriptional activation by STAT6 requires the direct interaction with NCoA-1. J Biol Chem. 276 (49): 45713-21.
  • Stutz AM, et al. (1999) Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 163 (8): 4383-91.
  • Yang J, et al. (2002) Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J. 21 (18): 4950-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.