Sino Biological - 공식 웹사이트

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene ORF cDNA clone expression plasmid (Codon Optimized)

Price:
Size:
Number:

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene ORF cDNA clone expression plasmid (Codon Optimized): General Information

Gene
Species
Influenza B
RefSeq ORF Size
1683 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACF54251.1.
Description
Full length Clone DNA of Influenza B (B/Florida/4/2006) Nucleocapsid protein.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene ORF cDNA clone expression plasmid (Codon Optimized): Alternative Names

NP cDNA ORF Clone, Influenza B; Nucleoprotein cDNA ORF Clone, Influenza B

Nucleocapsid/NP cDNA ORF Clone, H7N9, Related Products

Nucleocapsid/NP cDNA ORF Clone, H1N1, Related Products

Nucleocapsid/NP cDNA ORF Clone, Influenza B, Related Products

Nucleocapsid/NP cDNA ORF Clone, H9N2, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait