MERS CoV 3CLpro natural Gene ORF cDNA clone expression plasmid

Price:
Size:
Number:

MERS CoV 3CLpro natural Gene ORF cDNA clone expression plasmid: General Information

Gene
Species
MERS-CoV
RefSeq ORF Size
918 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of MERS CoV 3CLpro.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CoV 3CLpro / 3C-like protease Background Information

3C-like protease (3CLpro) is the main protease of Humann Coronavirus. 3C-like protease (3CLpro) is a key enzyme, as it cleaves several sites to produce non-structural proteins that are essential for genome replication and Coronavirus virion production, such as an RNA-dependent RNA polymerase, a helicase, ribonucleases and 3CLpro itself, from two types of polyproteins (pp1a and pp1ab). SARS-CoV 3CLpro exists as a homodimer and each protomer has an active site.
References
  • Tomonari Muramatsu,et al.Autoprocessing mechanism of severe acute respiratory syndrome coronavirus 3C-like protease (SARS-CoV 3CLpro) from its polyproteins.FEBS Journal.2013
  • Ziebuhr J,Molecular biology of severe acute respiratory syndrome coronavirus. Curr Opin Microbiol.2004
  • Yang H, et al. The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor. Proc Natl Acad Sci USA.2003

CoV 3CLpro / 3C-like protease cDNA ORF Clone, SARS, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.