ATF2 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

ATF2 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1464 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse activating transcription factor 2, isfrom 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI (6kb + 1.50kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

ATF2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATF2 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

ATF2 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Alternative Names

Atf-2 cDNA ORF Clone, Mouse; CRE-BP cDNA ORF Clone, Mouse; Creb2 cDNA ORF Clone, Mouse; D130078H02Rik cDNA ORF Clone, Mouse; D18875 cDNA ORF Clone, Mouse; mXBP cDNA ORF Clone, Mouse; Tg(Gzma-Klra1)7Wum cDNA ORF Clone, Mouse

ATF2 Background Information

Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways.
Full Name
activating transcription factor 2
References
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait